DSpace

University of Limpopo
Institutional Repository

 

University of Limpopo Institutional Repository >
Faculty of Science and Agriculture >
School of Molecular and Life Sciences >
Theses and Dissertations (Microbiology) >

Please use this identifier to cite or link to this item: http://hdl.handle.net/10386/89

Title: Enzymatic and molecular characterization of phytase producing yeasts isolated from soil in the Limpopo Province
Authors: Makhode, Matodzi Lizbeth
Keywords: Yeasts
Issue Date: 2008
Abstract: Twenty three phytase producing yeasts were isolated from soil in the Limpopo Province. The Limpopo Province has been found to be an ideal source of yeast able to function at high temperatures. The focus of this study was to profile the yeast isolates in terms of their phytase activities in order to confirm and establish the organism with the highest phytase activities. Three best phytase producing yeasts, HBD6.2, LD9 and LD7 were selected for further studies and illustrated activities of 676.02, 630.21 and 440.94 U.ml-1, respectively. HBD6.2, LD9 and LD7 were identified as Candida guilliermondii, Candida diddensiae and Candida famata, respectively, using standard conventional identification methods and PCR-RFLP was used to confirm the identities of these yeast isolates. Six known yeast strains obtained from the yeast culture collection (University of the Free State) were used as reference strains in the analysis. Pichia guilliermondii Y0209, Pichia guilliermondii Y0053 and Pichia guilliermondii Y0054 were used as reference strains for HBD6.2; Candida diddensiae for LD9; Debaryomyces hansenii Y0210 and Debaryomyces hansenii Y0610 as the reference strains for LD7. Eleven restriction digestion profiles used generated 84 markers with primers NS1 (5′ GTAGTCATATGCTTGTCTC 3′) and ITS2 (5′ GCTGCGTTCTTCATCGATGC 3′). The similarity matrix was generated with the DICE coefficient using the NTSYS (pc) program. The genetic distance between the taxa was used to generate a UPGMA (unweighted pair group method using arithmetic averages) phylogenetic tree with a bootstrap of 100 replications using the Treecon program. The three test yeasts did not cluster with their reference strains, however, C. guilliermondii HBD6.2 clustered closely with C. diddensiae Y0774 at a bootstrap value of 90 and have a similarity level of 100 %. C. diddensiae LD9 and C. diddensiae Y0774 are both within the same cluster separated by a bootstrap of 65, but shared a genetic similarity of 87 %. Candida famata LD7 was found to be distantly related to all the yeast strains and it was only genetically similar to its reference strains D. hansenii Y0209 and D. hansenii Y0610 at 51 % and 48 %, respectively. To determine the optimal growth and enzyme activities, the three yeast isolates were grown in PSM broth in shake flasks at temperature ranges of 25, 30 and 35º C and the following pHs 4.0, 4.5, 5.0, 5.5 and 6.0, for each temperature. The optimum growth temperature of the three test yeasts was 30º C for HBD6.2 at pH 5.5, LD9 at pH VI 6.0, and LD7 at pH 5.5 or 6.0. The maximum enzyme activity was also obtained when the organisms were grown at 30º C. Maximum enzyme activity for HBD6.2 and LD9 was reached at pH 5.0 or 6.0, LD7 at pH 5.5 or 6.0. Phytases from all three yeast isolates were stable at 35º C, pH 5.5 for an average of 3 hrs retaining almost 80 % residual activity under these optimal conditions.
Description: Thesis (Microbiology)--University of Limpopo, 2008
URI: http://hdl.handle.net/10386/89
Appears in Collections:Theses and Dissertations (Microbiology)

Files in This Item:

File Description SizeFormat
Title etc.pdf00front127.39 kBAdobe PDFView/Open
Final document.pdf01thesis1.53 MBAdobe PDFView/Open
View Statistics

Items in DSpace are protected by copyright, with all rights reserved, unless otherwise indicated.

 

DSpace Software Copyright © 2002-2010  Duraspace - Feedback