<?xml version="1.0" encoding="UTF-8"?>
<feed xmlns="http://www.w3.org/2005/Atom" xmlns:dc="http://purl.org/dc/elements/1.1/">
  <title>DSpace Collection:</title>
  <link rel="alternate" href="http://hdl.handle.net/10386/72" />
  <subtitle />
  <id>http://hdl.handle.net/10386/72</id>
  <updated>2013-05-21T07:04:10Z</updated>
  <dc:date>2013-05-21T07:04:10Z</dc:date>
  <entry>
    <title>Screening, isolation and characterization of lectins extracted from mushrooms indegenous to Southern Africa</title>
    <link rel="alternate" href="http://hdl.handle.net/10386/805" />
    <author>
      <name>Maribeng, Reagile</name>
    </author>
    <id>http://hdl.handle.net/10386/805</id>
    <updated>2013-05-04T22:00:55Z</updated>
    <published>2011-01-01T00:00:00Z</published>
    <summary type="text">Title: Screening, isolation and characterization of lectins extracted from mushrooms indegenous to Southern Africa
Authors: Maribeng, Reagile
Abstract: Lectins are among a large number of proteins produced by mushrooms. Mushroom lectins with important biological functions have been isolated and studied. However, none of the studies were reported on lectins isolated from mushrooms indigenous to southern Africa. A galactose-specific lectin from one of the common mushroom species in southern Africa, Schizophyllum commune, was isolated and characterized. Initially, twenty mushroom samples were collected and their crude extracts screened for lectin activities. Assays involved in the screening procedures included heamagglutination, carbohydrate inhibition, enzyme linked glycoprotein (ELGA) and various stability assays. Four different mushroom samples exhibited positive lectin activities with varying stabilities towards thermal treatment and susceptibility to proteolytic degradation. Further screening assays resulted in ZHR1 being selected for identification and purification of the lectin. This was due to its ability to agglutinate rabbit erythrocytes. In addition to its activity being destroyed after 3 hours of treatment with trypsin-NIPAAM conjugate, the activity of this lectin was also completely destroyed after an hour incubation in boiling water. In contrast to other mushroom extracts assayed, heamagglutination activity of the crude extract of ZHR1 was not inhibited by glycoproteins only but also by the sugars such as galactose, lactose and mannose. ZHR1 was identified as S. commune. S. commune lectin (ScL) was purified using affinity chromatography on a fetuin-agarose column and further purified using gel-filtration chromatography on Biogel P-100 column. ScL was characterized as a glycosylated, galactose-specific dimeric lectin with a molecular weight of approximately 32 and 33 kDa. ScL is a thermolabile lectin which loses its activity as early as 5 minutes after being incubated at 60°C. Anti-ScL antibodies, to be employed in screening for the presence of ScL in the protein extracts, were developed in the rabbits and their interaction with ScL was detected using the double immunodiffusion assays whereas their specificity towards the lectin was detected using Western blot. ScL is one of the first mushroom lectins to be isolated and studied in southern African region. If the lectin is found to be exhibiting important biological functions, ScL can be of commercial importance in the region.
Description: Thesis (M.Sc. (Microbiology)) -- University of Limpopo, 2011</summary>
    <dc:date>2011-01-01T00:00:00Z</dc:date>
  </entry>
  <entry>
    <title>Metazoan parasites and health of selected cyprinids at Nwanedi-Luphephe dams</title>
    <link rel="alternate" href="http://hdl.handle.net/10386/748" />
    <author>
      <name>Mbokane, Esau Mathews</name>
    </author>
    <id>http://hdl.handle.net/10386/748</id>
    <updated>2013-04-13T22:00:56Z</updated>
    <published>2011-01-01T00:00:00Z</published>
    <summary type="text">Title: Metazoan parasites and health of selected cyprinids at Nwanedi-Luphephe dams
Authors: Mbokane, Esau Mathews
Abstract: The present MSc dissertation emanates from seasonal surveys conducted by the fish parasitological group of the Department of Biodiversity and Aquaculture Research Unit of the University of Limpopo, Turfloop Campus. The first part of the present study was aimed at investigating the metazoan parasites of three cyprinids occurring in the Nwanedi-Luphephe Dams. The main purpose of it was to determine temporal  changes  in  the  intensity  of  infestation  in  terms  of  prevalence,  mean intensity and abundance of parasite species parasitizing the cyprinids studied over a two  year  period.  Ecological  parameters  including  species  host-specificity, seasonality, and gender preference and host size versus species intensity are discussed for each parasite.&#xD;
Altogether 152 specimens were examined for parasites and a total of 2 432 metazoan parasites of ten species were recorded. At the sampling site, all three hosts  co-occurred,  however,  a  substantial  proportion  of  Barbus  radiatus  was collected from the perennial stream feeding one of the twindams. Fish were sampled by means of gill nets and electrofishing or seine netting in accordance with the habitat conditions. Hosts were killed and organs investigated for metazoan parasites. After collection of parasites, standard methods for processing individual parasites were followed. The results obtained revealed the following groups of parasites; monogeneans (ectoparasites) included Dactylogyrus spinicirrus, D. afrolongicornis afrolongicornis, D. afrolongicornis alberti, Afrodiplozoon polycotyleus, Gyrodactylus sp., and Dogielius sp. (all recorded from the gills); Crustacea, Dolops ranarum was found from the mouth cavity, gills and skin of Labeobarbus marequensis. Of these, only two specialists, both monogeneans, were found on Barbus trimaculatus namely, D.   afrolongicornis   afrolongicornis   and   D.   afrolongicornis   alberti.   Based   on morphology of the haptoral hard parts, these two species were almost similar to each other than to D. spinicirrus. The appreciable difference between D. afrolongicornis afrolongicornis and D. afrolongicornis alberti was mainly in the shape of the marginal bar. Both D. spinicirrus and A. polycotyleus were widely distributed and recorded on the gills of all hosts during all seasons. Both species were recorded for the first time on B. radiatus. Also, D. spinicirrus was recorded for the first time on the gills of B. trimaculatus. Based on comparison with the original material, the species could be identified  to  species  level.  These  analyses  provided  sufficient  evidence  for&#xD;
 &#xD;
restoration of Afrodiplozoon polycotyleus as a valid taxon. The existence of two species, Gyrodactylus sp. and Dogielius sp. were recorded for the first time on B. radiatus in South Africa, and this possibly represents new species.&#xD;
The  endoparasites  included  the  following  groups:  digeneans- Diplostomulum  metacercariae  from  the  eyes  of  Lb.  marequensis, Ornithodiplostomum sp. and black spot (grubs) were recorded from B. trimaculatus. The latter was also recorded in the muscle of B. radiatus. Unidentified digenean cysts were recovered from the gills and in the body cavity of both Lb. marequensis and B. trimaculatus; nematodes were represented by Contracaecum larvae in the body   cavity   of   both   Lb.   marequensis   and   B. trimaculatus;   cestodes   were represented by gryporynchid larvae from the intestine of B. radiatus. The general high prevalence and intensities of ectoparasites recorded is an indication that the Nwanedi-Luphephe Dams has a biotic mechanism which might have enabled it to sustain the growth rate of ectoparasite intra-population. There was no correlation between either fish length or condition factor and the number of parasites. The study indicated that the abundance of monogeneans is partly influenced by season and that of endoparasites was principally governed by the presence of intermediate hosts and definitive hosts.&#xD;
The  second  part  of  this  dissertation  dealt  with  the  health  status  of Lb. marequensis. Fish health was assessed using condition-related indices including condition factor and a modified Health Assessment Index (HAI) and the associated Parasite Index (PI). The HAI was performed to determine and examine any macroscopic abnormalities regarding external features and internal organs. The purpose of combining the two indices was to use the infestation of the metazoan parasites found on and/or in Lb. marequensis to determine whether or not the environment they live in was healthy. Both indices together with the condition factor provided relatively simple and rapid indications of how well fish were coping in their environment. The HAI score varied amongst the four sampling seasons. The highest individual mean value was 63 in winter, followed by a score of 50 in autumn, while the lowest were 42 and 33 in summer and spring respectively. To authenticate the HAI and PI data, certain water quality variables were measured and are discussed in detail in this dissertation. The Nwanedi-Luphephe Dams are generally believed to have good water quality. This was supported in this study; conditions assessed in fish using the aforementioned indices did not differ&#xD;
 &#xD;
greatly between seasons, nor did the conditions deviate appreciably from normality. The HAI values were low overall which signifies a healthy fish profile for the system. The present investigation showed the existence of differences in the occurrence of individual parasite to be linked to water temperature changes. Thus, seasonal changes do influence parasite developmental stages to a certain degree. Tested heavy and trace metals were within the permissible limits as provided by the Department of Water Affairs and Tourism (DWAF, 1996).
Description: Thesis (M.SC. (Aquaculture)) --University of Limpopo, 2011</summary>
    <dc:date>2011-01-01T00:00:00Z</dc:date>
  </entry>
  <entry>
    <title>Screening, isolation and purification of bioactive compounds with antibacterial activity against mycobacterium smegmatis</title>
    <link rel="alternate" href="http://hdl.handle.net/10386/524" />
    <author>
      <name>Mmushi, Tshepo Joseph</name>
    </author>
    <id>http://hdl.handle.net/10386/524</id>
    <updated>2012-09-15T22:00:56Z</updated>
    <published>2011-01-01T00:00:00Z</published>
    <summary type="text">Title: Screening, isolation and purification of bioactive compounds with antibacterial activity against mycobacterium smegmatis
Authors: Mmushi, Tshepo Joseph
Abstract: The leaves of fifteen plant species were collected from the Lowveld Botanical Garden in Nelspruit, Mpumalanga Province, South Africa. The collection was based on a list of plants and their ethnopharmacological information provided by the Phytomedicine Programme at the University of Pretoria. The dried leaves of the plants were powdered and extracted using hexane, dichloromethane, acetone and methanol. The extracts were screened for antibacterial activity against Mycobacterium smegmatis and Rhodococcus erythropolis. The acetone extract of Milletia stulhimannii was the most active, showing activity against Mycobacterium smegmatis and Rhodococcus erythropolis with MIC values 0.13 and 0.08 mg/ml, respectively. Acetone extracts for all plants had the lowest MIC values ranging between 0.11-1.25 mg/ml and 0.08-1.25 mg/ml for M. smegmatis and R. erythropolis, respectively. Milletia stulhimannii, Albizia gummifera, Xanthocercis zambesiaca and Barringtonia racemosa extracts have shown the greatest potential for anti-tubercolosis agents. These were all active against M. smegmatis with an average MIC value of acetone extracts of 0.13 mg/ml. Apodytes dimidiata was selected for the isolation of active compounds since its activity on qualitative antibacterial activity assays was highly prominent on TLC plates in comparison to the other plant extracts. Two compounds were isolated from A. dimidiata but after purification, their MICs were above 2.5 mg/ml indicating a possible loss of activity during purification. The preliminary NMR spectra analysis suggested that the compounds were a long fatty acid and a triterpene. Future work is required to elucidate the chemical structures of the latter compounds and to test the activity of these compounds against Mycobacterium tuberculosis.
Description: Thesis (M.Sc. (Microbiology)) --University of Limpopo, 2011</summary>
    <dc:date>2011-01-01T00:00:00Z</dc:date>
  </entry>
  <entry>
    <title>Enzymatic and molecular characterization of phytase producing yeasts isolated from soil in the Limpopo Province</title>
    <link rel="alternate" href="http://hdl.handle.net/10386/89" />
    <author>
      <name>Makhode, Matodzi Lizbeth</name>
    </author>
    <id>http://hdl.handle.net/10386/89</id>
    <updated>2011-09-02T09:38:50Z</updated>
    <published>2008-01-01T00:00:00Z</published>
    <summary type="text">Title: Enzymatic and molecular characterization of phytase producing yeasts isolated from soil in the Limpopo Province
Authors: Makhode, Matodzi Lizbeth
Abstract: Twenty three phytase producing yeasts were isolated from soil in the Limpopo Province.&#xD;
The Limpopo Province has been found to be an ideal source of yeast able to function at&#xD;
high temperatures. The focus of this study was to profile the yeast isolates in terms of&#xD;
their phytase activities in order to confirm and establish the organism with the highest&#xD;
phytase activities. Three best phytase producing yeasts, HBD6.2, LD9 and LD7 were&#xD;
selected for further studies and illustrated activities of 676.02, 630.21 and 440.94 U.ml-1,&#xD;
respectively. HBD6.2, LD9 and LD7 were identified as Candida guilliermondii,&#xD;
Candida diddensiae and Candida famata, respectively, using standard conventional&#xD;
identification methods and PCR-RFLP was used to confirm the identities of these yeast&#xD;
isolates. Six known yeast strains obtained from the yeast culture collection (University of&#xD;
the Free State) were used as reference strains in the analysis. Pichia guilliermondii&#xD;
Y0209, Pichia guilliermondii Y0053 and Pichia guilliermondii Y0054 were used as&#xD;
reference strains for HBD6.2; Candida diddensiae for LD9; Debaryomyces hansenii&#xD;
Y0210 and Debaryomyces hansenii Y0610 as the reference strains for LD7. Eleven&#xD;
restriction digestion profiles used generated 84 markers with primers NS1 (5′&#xD;
GTAGTCATATGCTTGTCTC 3′) and ITS2 (5′ GCTGCGTTCTTCATCGATGC 3′).&#xD;
The similarity matrix was generated with the DICE coefficient using the NTSYS (pc)&#xD;
program. The genetic distance between the taxa was used to generate a UPGMA&#xD;
(unweighted pair group method using arithmetic averages) phylogenetic tree with a&#xD;
bootstrap of 100 replications using the Treecon program. The three test yeasts did not&#xD;
cluster with their reference strains, however, C. guilliermondii HBD6.2 clustered closely&#xD;
with C. diddensiae Y0774 at a bootstrap value of 90 and have a similarity level of 100 %.&#xD;
C. diddensiae LD9 and C. diddensiae Y0774 are both within the same cluster separated&#xD;
by a bootstrap of 65, but shared a genetic similarity of 87 %. Candida famata LD7 was&#xD;
found to be distantly related to all the yeast strains and it was only genetically similar to&#xD;
its reference strains D. hansenii Y0209 and D. hansenii Y0610 at 51 % and 48 %,&#xD;
respectively. To determine the optimal growth and enzyme activities, the three yeast&#xD;
isolates were grown in PSM broth in shake flasks at temperature ranges of 25, 30 and 35º&#xD;
C and the following pHs 4.0, 4.5, 5.0, 5.5 and 6.0, for each temperature. The optimum&#xD;
growth temperature of the three test yeasts was 30º C for HBD6.2 at pH 5.5, LD9 at pH&#xD;
VI&#xD;
6.0, and LD7 at pH 5.5 or 6.0. The maximum enzyme activity was also obtained when&#xD;
the organisms were grown at 30º C. Maximum enzyme activity for HBD6.2 and LD9&#xD;
was reached at pH 5.0 or 6.0, LD7 at pH 5.5 or 6.0. Phytases from all three yeast isolates&#xD;
were stable at 35º C, pH 5.5 for an average of 3 hrs retaining almost 80 % residual activity under these optimal conditions.
Description: Thesis (Microbiology)--University of Limpopo, 2008</summary>
    <dc:date>2008-01-01T00:00:00Z</dc:date>
  </entry>
</feed>

